Avena sativa Markers Preview

Chromosome Chr00 @ 117228267



Genotype locations  
Marker Protocol Species Reference Chromosome Position Ref Alt
GMI_GBS_2049 Infinium 2010 Avena sativa Consensus_2018 Chr00 117228267 A G
Flanking Sequence  

GMI_GBS_2049

TCAAATAATAATTGAGATGGTCCAAATCCAGAATACTAGGCCAGTTCCTGTA[A/G]TAATTTCTGCA


Related Markers  

Related Genotyped Markers: These genotyped markers share either the same name as one or more markers at this variant or are located at the same position but have different allele values

Related Mapped Markers: These mapped markers have the same name as a marker at this variant

View More Information

To view all of the information about this variant, create an account and log in.


 Create an Account  Login