T3/Oat

clone(s) in cart (order)

Old browser version detected

This site is optimized for modern web browsers

Please upgrade your browser

Sorry!, some features may not work in outdated browsers

T3/Oat

Search
Manage
Analyze
- Breeder Tools
- Breeder Home
- Selection Index
- Population Structure
- Clustering
- GWAS
- Accession Usage
- Compare Trials
- Summarize Trials
- Sequence Analysis
- BLAST
Maps
About

This site uses cookies to provide logins and other features. Please accept the use of cookies by clicking Accept.

Avena sativa Markers Preview

Chromosome Chr00 @ 117228267

Genotype locations

Marker	Protocol	Species	Reference	Chromosome	Position	Ref	Alt
GMI_GBS_2049	Infinium 2010	Avena sativa	Consensus_2018	Chr00	117228267	A	G

Flanking Sequence

GMI_GBS_2049

TCAAATAATAATTGAGATGGTCCAAATCCAGAATACTAGGCCAGTTCCTGTA[A/G]TAATTTCTGCA

Related Markers

Related Genotyped Markers: These genotyped markers share either the same name as one or more markers at this variant or are located at the same position but have different allele values

Loading...

Related Mapped Markers: These mapped markers have the same name as a marker at this variant

Loading...

View More Information

To view all of the information about this variant, create an account and log in.

Create an Account Login

Your Lists

Public Lists

List Contents

List Validation Report: Failed

Elements not found:

Optional: Add Missing Accessions to A List

Mismatched case

Click the Adjust Case button to align the case in the list with what is in the database.

Multiple mismatched case

Items listed here have mulitple case mismatches and must be fixed manually. If accessions need to be merged, contact the database directly.

List elements matching a synonym

Multiple synonym matches

Multiple synonym matches have to be resolved manually. Contact database administrators if necessary.

Fuzzy Search Results

Synonym Search Results

Create a New List from Unique Names:

Available Seedlots

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Create a New List from Selected Seedlots:

Manage Seedlots

Your Datasets

Public Datasets

Dataset Contents

Dataset Validation Failed

Elements not found:

Your Calendar

Having trouble viewing events on the calendar?
Are you associated with the breeding program you are interested in viewing?

Calendar Permissions

Add New Event

Project:

Event Type:

Start:

End:

Description:

Web URL:

http://www.

Event Info

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

Edit Event

Project:

Event Type:

Start:

End:

Description:

Web URL:

Login

Forgot Username

If you've forgotten your username, enter your email address below. An email will be sent with any account username(s) associated with your email address.

Email Address

Reset Password

To reset your password, please enter your email address. A link will be sent to that address with a link that will enable you to reset your password.

Email Address

Create New User

Notice

Before creating a new account, please check if you already have an account using the directory search.
A link will be emailed to you. Please click on it to activate the account.
All fields are required.

First Name:

Last Name:

Breeding Program(s):

Username:

Username must be at least 7 characters long.

Password:

Password must be at least 7 characters long and different from your username.

Confirm Password:

Password must be at least 7 characters long and different from your username.

Email Address:

An email will be sent to this address requiring you to confirm its receipt to activate your account.

Mailing List Subscription:

Email address already subscribed

You can unsubscribe by following the link at the bottom of an email from the mailing list.

Signup for occasional news and updates

We'll send you an email a few times per year with updates about new features and tools added to the website. You can unsubscribe at any time.

Avena sativa Markers Preview

Chromosome Chr00 @ 117228267

Powered By

Partners

Funded By