Avena sativa Markers Preview

Chromosome Un @ 314660



Genotype locations  
Marker Protocol Species Reference Chromosome Position Ref Alt
avgbs_cluster_35655.1.23 Tinker QTL 2021 Avena sativa OT3098 v2 Un 314660 A G
avgbs_cluster_35655.1.23 GBS POGI v2 Avena sativa OT3098 v2 Un 314660 A G
Flanking Sequence  

avgbs_cluster_35655.1.23, avgbs_cluster_35655.1.23

TGCAGTAGCCAAGGCAGCGCCC[A/G]CCTTCTCGGCCTAGATCTRGCCCCACCGAGATCGGAAGAGC


Related Markers  

Related Genotyped Markers: These genotyped markers share either the same name as one or more markers at this variant or are located at the same position but have different allele values

Related Mapped Markers: These mapped markers have the same name as a marker at this variant

View More Information

To view all of the information about this variant, create an account and log in.


 Create an Account  Login