Avena sativa Markers Preview
Chromosome Un @ 363430
Genotype locations
|
| Marker | Protocol | Species | Reference | Chromosome | Position | Ref | Alt |
|---|---|---|---|---|---|---|---|
| avgbs_cluster_49983.1.14 | GBS POGI v2 | Avena sativa | OT3098 v2 | Un | 363430 | C | G |
| avgbs_cluster_49983.1.14 | Tinker QTL 2021 | Avena sativa | OT3098 v2 | Un | 363430 | C | G |
Flanking Sequence
|
avgbs_cluster_49983.1.14, avgbs_cluster_49983.1.14
TGCAGTCGATCTC[C/G]TCGGCTTGGCGCGACGCACCGAGATCGGAAGAGCGGTTCAGCAGGAATGC
Related Markers
|
Related Genotyped Markers: These genotyped markers share either the same name as one or more markers at this variant or are located at the same position but have different allele values
Related Mapped Markers: These mapped markers have the same name as a marker at this variant
View More Information
To view all of the information about this variant, create an account and log in.
Create an Account Login
Genotype locations
Genotype locations