Avena sativa Markers Preview

Chromosome Un @ 536420



Genotype locations  
Marker Protocol Species Reference Chromosome Position Ref Alt
avgbs2_154075.1.37 GBS POGI Avena sativa PepsiCo v1 Un 536420 G T
Flanking Sequence  

avgbs2_154075.1.37

TGCAGGGGAGCCTCCTCAACGTGCTAGAGTCGGAGC[G/T]CCTGGTGCTKCTGGGCGATAACRCAYG


Related Markers  

Related Genotyped Markers: These genotyped markers share either the same name as one or more markers at this variant or are located at the same position but have different allele values

Related Mapped Markers: These mapped markers have the same name as a marker at this variant

View More Information

To view all of the information about this variant, create an account and log in.


 Create an Account  Login